Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_465H12-3
Clone ID CMHD-GT_465H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_465H12-3
Sequence
CCGATGCCTGAGTGGCGTCCACCCGGTATCCCCTCTGGGGTCGAGGATTTTAACTGACCCCGCCAAAGTTTTTGAACACA
ACATGTGGGATCACATGCAGTGGTCTAAAGAAGAAGAAGACGCAGCTAAAAAAAAAGAAGAGGAAAACTCAGCCACTCTA
CTCGCTCCAGAAAAGCAAAGTAAGGCTGGCATCCTGTCCCAGCATTTGGAAGTTCTGAGCTGCCACCCCAGCCAGTCAAC
CCATTTGCTACCTTTGGTGGGATTCCCAGTTCTTCCCTTGTAGTGGAACCGAAATTAATGAAATAAATTATGTATTCACC
CTG
Sequence Type mRNA
Unitrap ID UNI14175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70831397..70856363 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041975 (Mettl8) NP_663499 methyltransferase like 8 Gene [Source:MGI (curated);Acc:Mettl8-002]

 
Come back to gene ENSMUSG00000041975


For any suggestions or comments, please send an email to unitrap@crg.es