Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_465C10-3
Clone ID CMHD-GT_465C10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_465C10-3
Sequence
CCCTCACAAGCTTCTCGCCGCACGGCTGCAATGCTCCGCTCTTCTTCTCCGGGACACCTCGAACCTGCTCAAGCGCTGCC
ATGGATCCCAGGCCAGCTACCTCTTCCAGCAAGACAAGTTCTACGATGTGGCTCTGGACACCGGAAACAAAGTGGTGCAG
TGTGGCCGCCGCGTGGACTGTCTGAAGCTATGGCTCATGTGGAAGGCACAGGGTGGGCAGGGGTTGGAGCGGCGCATCGA
CCAGGCCTTTGCTCTCACCCGGTACTTGGTGTACGAGAGTAAAACTCGGAAAGGATTTGAATTGTTAAGGGAGCCAAAGA
GCGTCAACGTATCCTCCTGGTTTGGGCCCCCGAGCCGCCTGGGGACAAAGGACAGTCCAAAGTCAAGGTAAACGCTGTCC
CTGGCGACCTCGGCCTTGGGGGACGGGACGGGTAATAAG
Sequence Type mRNA
Unitrap ID UNI21067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102009212..102010012 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023044 (Csad) NM_144942 cysteine sulfinic acid decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2180098]

 
Come back to gene ENSMUSG00000023044


For any suggestions or comments, please send an email to unitrap@crg.es