Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_497A10-3
Clone ID CMHD-GT_497A10-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_497A10-3
Sequence
TGACCAAGAACATGCCTGAACTTTAAGAAATGGCTTTCCACGTTGCCCCCACCTGAACCCTGTCTCTCCTGCCCTTCTCA
GCTCCACTCTGAAGTTTCCTCTCCTGTCCTGCTCACGTGTGTGAGCCTGTCCTCTCCTACCTATGAGCCCTCTCTCTCTG
TGTGGCAAACATTTAAAG
Sequence Type mRNA
Unitrap ID UNI13048

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 42248983..42249160 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047261 (Gap43) NM_008083 growth associated protein 43 Gene [Source:MGI (curated);Acc:Gap43-001]

 
Come back to gene ENSMUSG00000047261


For any suggestions or comments, please send an email to unitrap@crg.es