Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_492H6-3
Clone ID CMHD-GT_492H6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_492H6-3
Sequence
CGTGGGGGTCCAGAGTGACCGTCGTGGCTGCTGCTTGTCACCAGACAGAAGGGTTAGCTTTACAATAAAGGACTTCCACA
ATGTCAAATGAAAAGTCATATATTAAACAACCTTAATAAATATTCTGTGAGCAGAATGAAGTACAGAAACTCCAGGTGGT
CACTTGTATCTCCTACACTGTGTATCTCGGTCAGCTGCCCCACAAGCTGCCCTGTACACTTATTAAAGTCTACATTTTTA
AATGCTAGCCTATTAACTTGACTCTTGATTATGAAATGTTCCCAGCGATGAGCTATTAAAAGCACATAGTATCT
Sequence Type mRNA
Unitrap ID UNI29304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101505916..101506228 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061474 (Mrps36) NM_025369 mitochondrial ribosomal protein S36 Gene [Source:MGI (curated);Acc:Mrps36-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54005742..54006054 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021631 (AC162800.2)  

 
Come back to gene ENSMUSG00000021631


For any suggestions or comments, please send an email to unitrap@crg.es