Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_492B2-3
Clone ID CMHD-GT_492B2-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_492B2-3
Sequence
ATCAAGGACCTCCGGGACCACAAGCTTGACAACCGCATGGAGTCTTTCTTCCTGGCTGAAACTGTGAAATACCTCTATCT
TCTGTTCCACCCAAACAACTTCATCCACAACAATGGCTCCACCTTTGACTCTGTGATGACTCCCCATGGGGAGTGCATCC
TAGGAGCCGGGGGCTACATCTTCAACACGGAGGCTCACCCCATTGACCCTGCTGCCTTGCACTGCTGCCGGAGGCTCAAG
GAGGAGCAGTGGGAAGTGGAGGACTTGATAAAGGAGTTCTACTCCCTCAAACAGAGCAGGCCAAAGAGAGCTCAGAGGAA
GACAGTGAGGTCGGGGCCCTGGGAGCCCCAGTCAGGGCCAGCCACACTCTTCTCACCTGCAAACCAGCCCAGGGAGAAGC
AGCCTGCCCGGCAGCGAACCCCGCTTCTCAGCTGCCCCAGCCAGCCCTTCACCTCTAAGCTGGCATTGCTAGGCCAGGTT
TTCCTAGACTCCTCATAGCCACTGGATAATTTTCTAATTTTTATTTTTTTGAGACTAAGCTCTAATAATAAATCTGCTTT
TGGCTAAC
Sequence Type mRNA
Unitrap ID UNI37276

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155527763..155528328 560
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038312 (Edem2) NM_145537 ER degradation enhancer, mannosidase alpha-like 2 Gene [Source:MGI (curated);Acc:Edem2-001]

 
Come back to gene ENSMUSG00000038312


For any suggestions or comments, please send an email to unitrap@crg.es