Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_461C11-3
Clone ID CMHD-GT_461C11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_461C11-3
Sequence
CCCCCTCACCTGCACCTACATGCTCCCCTTCCCCTGCACCCGCTTATGCCCCCTCACCTGCCCCCAACTATACCCCTACA
CCGTCAGCTGCCTACAGTGGGGGCCCTTCCGAATCTGCCAGCCGTCCACCCTGGGTGACCGATGACTGCTTCTCTCACAA
GTTTGCTCCTGGAAAGAGCACTACCACTGTCAGCAAGCAGACCCTGCCCCGGGGGGCTCCAACCTACCACCCAACAGGTC
CCCCAGTGACTCCTCTTGCCAGGGGCACCTTCCACAGAGCTGACCGCTTCCCAGCTAGCAGCCGGACTCCCCTCTGTGGG
CACTGTAACCATGTCGTCCGGGGCCCTTTTCTGGTGGCCATGGGCCGCTCTTGGCACCCACAAGAGTTCAATTGTGCCTA
CTGCAAGACCTCCCTAGCTGATGTGTGCTTTGTGGAGGAGCCGAACGATGTTTACTGCGAGCGGTGTTACGAGCAGTTCT
TTGCCCCTATCTGTGCCAAATGTAACACCAAAATCATGGGGGAAGTGATGCACGCTCTGCCACAGACATGGCACACCACC
TGCTTCGTCTGTGCTGCCTGCAAGAAACCCTTT
Sequence Type mRNA
Unitrap ID UNI37279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35355103..35357498 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021798 (Ldb3) NM_001039076 LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]

 
Come back to gene ENSMUSG00000021798


For any suggestions or comments, please send an email to unitrap@crg.es