Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_461H9-3
Clone ID CMHD-GT_461H9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_461H9-3
Sequence
GGGCTGCTCCTCCAGTTAAAGGACATCAATCATTTCCTAATGCAAGACATTGCTTTCCTGTCTGGTGGCCGGGGAAAGGA
CAATGCTTGGATCATTACATTTCC
Sequence Type mRNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57408855..57413467 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es