Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_462B8-3
Clone ID CMHD-GT_462B8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_462B8-3
Sequence
GGAATCCCTCACAGTCCACGTCCCTCCACTACATGAGTCCCTACCAGCTGAACGCCTACGCGCTGGCGCTGACCGCCGTC
GGAGAAATCATCCAGCATTATGACAGTGACAAGATGTTCCCTGCCCTGGGCTTCGGGGCCAAGCTGCCCCCCGACGGCAG
GGTGTCCCATGAGTTTCCCCTGAATGGCAACCAGGAGAACCCCTCCTGGCTGTGGCATCGATGGCATCCTGGAGGCCTAC
CACAGCAGCCTGCGCACCGTGCAGCTTTACGGCCCCACTAACTTTGCTCCTGTTGTCACTCACGTAGCCAGGAACGCCGC
AGCTGTGCAGGATGGCTCCCAGTATTCTGTGCTGCTCATCATCACTGATGGTGTCATCTCGGACATGGCACAGACCAAGG
AGGCAATTGTAAATGCTGCCAAACTCCCATCCCACCCGCCTGTCCCGCATGGTGATAGTGATGTTTTGACTGTCTGGTCC
TGTGCCTGTCTGAGACTGTCTCTGTGGAACTTGCCTTAAATTGAAGTAAACCAGTTCTTTTAGT
Sequence Type mRNA
Unitrap ID UNI37283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29294860..29299379 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es