Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_455G3-3
Clone ID CMHD-GT_455G3-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_455G3-3
Sequence
AGCAATACTATGATGTCCTCCACAAGTACCACAACCCAAGAAACGACGTCTAATGTATGAGAAAGTCCCTGGAAGAGTGG
ATGGGCAAACCCGGCTGAAGTTTTTATGAAAAAAACAGAAGGGACAGTGCCACCTGCCAGATTCTATTTCCTTATGCCAA
TCCAGTAACCAAGTATTTAGGCTTGACTCCACATCAAAGAAAATGCCATTGTTTTTACATGTCCTCGGTGTTTATATCTA
AGTCTGCTTGTCTGACTTATCAATTAACATAATAAGCATAACCCCCCCCCC
Sequence Type mRNA
Unitrap ID UNI28519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59056557..59056834 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038598 (AI481877) Likely orthologue of H. sapiens chromosome 9 open reading frame 84 [Source:UniProtKB/TrEMBL;Acc:A2ALV5]

 
Come back to gene ENSMUSG00000038598


For any suggestions or comments, please send an email to unitrap@crg.es