Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418604
Clone ID OST418604
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418604
Sequence
ACTGAGGAATAACTCAGGTCACGCTGACTGGAAATCAGTTGACTGACATCAGTGAAGCAGTGGTTCCTGAGTTTGAAGAA
AAGAGGTCTCCTGCCTGGACAGAGGAGTGTGTGCCTTTCTCCAAGCCGTCTCTGGACATATCTTCCCAGCATCCTCTAAC
AAAGATGCGTCAACTCAAAGGGAAGCCAAAGAAAGAGACCTCCAAGGACAAGAAGGAGCGGAAGCAGGCCATGCAGGAGG
CGCGGCAGCAGATCACCACTGTGGTGCTGCCCACCCTGGCTGTGGTGGTGCTCCTCATTGTCGTGTTTGTGTATGTGGCC
ACACGCCCCGCCGTCACCGAGTGAGCACGTCCATTCTGCTTTCCTCTGCAGAGATGTCCGAAATGCCAAGCTCTGAGCAG
GAGTGCCCTGTCTCCTCTGGTCTTTGACTTGATCAATATTTCTCTACTTTTTTGGGGGGTGGGGGTGG
Sequence Type mRNA
Unitrap ID UNI18658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15330070..15349363 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058173 (BC017612) NM_133214 UPF0443 protein C11orf75 homolog (Protein FN5) [Source:UniProtKB/Swiss-Prot;Acc:Q9JIS3]

 
Come back to gene ENSMUSG00000058173


For any suggestions or comments, please send an email to unitrap@crg.es