Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_455E5-3
Clone ID CMHD-GT_455E5-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_455E5-3
Sequence
TTCGCAAGTGTAGGCAGAACGCCAGTCCTGCCTTAGAAGAGGGAAGTGCATCACGTGGGGCTGCTGAGTTTCGGGTCATC
TGCGTTTTCCTTTCTTTGCTGAACTAATAAAGGCCAGTGCTTAGTCTT
Sequence Type mRNA
Unitrap ID UNI25877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88954229..88954356 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072553 (Gm525) NM_001033266 gene model 525, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685371]

 
Come back to gene ENSMUSG00000072553


For any suggestions or comments, please send an email to unitrap@crg.es