Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_465B7-3
Clone ID CMHD-GT_465B7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_465B7-3
Sequence
GGTTTGTACCTGCTATGGAGGAAGCCGGGGTTTTAACTGCGAGAGCAAGCCTGAGCCTGAAGAGACTTGCTTTGACAAAT
ACACTGGGAACACTTACAAAGTGGGTGACACTTATGAGCGCCCTAAAGATTCCATGATCTGGGACTGTACCTGCATCGGG
GCTGGGAGAGGCAGGATCAGCTGTACCATTGCAAATCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGCGACAAGTG
GAGGAGGCCACATGAGACTGGTGGCTACATGTTAGAGTGTCTGTGCC
Sequence Type mRNA
Unitrap ID UNI29586

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71695809..71698150 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es