Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_457A2-3
Clone ID CMHD-GT_457A2-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_457A2-3
Sequence
AGAATCACCACTGTCCGAAACTGTGGCCACATTTTCTGCAACACCTGCTCTAGCAACGAGCTGGCCCTGCCCTCCTACCC
TAAGCCAGTGCGTGTGTGTGACAGCTGCCATACCCTGCTACTGCAGCGCTGCTCCTCCACTGCCTCCTGAAGCCATCAGC
CCCACCCACCAGCAGGGACCTTGACCTGTTGACCTCCATCCTCAGAGTGGAGGAAAGCCTCAGGTACAGTGCCAAACTTG
GGATCTCCAGAGACCTGTAGGGACCCAAGAGAATCAAAGGAAAGAATGAAACCTTCACCCGGCTGTCATCCTCCGAATAA
AATGCCAAGTGGCAGCTGAGCACTTTTCCATGGTCTCTATGGAGTCATCTCCTCTAGACAGACACTTCTGTGTCCTCAGT
TAAATCCTGGCTTTGGTACAGGTGCAACTTCATGACTTTGCTACTGTCACCTTCACTTTTCAAAGGGTTAACCTGTTGTG
CAGCAGTTGCACTAGAGAATCCTTTCTCTTTCCTACCCACGTCCCACAGAAACCTTGATTTCTGCTGTGCTTTGAACCTT
GTGGGTCTGTCAGTGTGCCTTGTCTGCTTCGGCATCCAGCATTTGCCATCATGCTCCTGCCAACACCTACTGTCAGCCCT
GCAATAAAATCCTTTATTTTTCACTCTTGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI28546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50202788..50203460 656
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020375 (Rufy1) NM_172557 RUN and FYVE domain containing 1 Gene [Source:MGI (curated);Acc:Rufy1-001]

 
Come back to gene ENSMUSG00000020375


For any suggestions or comments, please send an email to unitrap@crg.es