Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_456D10-3
Clone ID CMHD-GT_456D10-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_456D10-3
Sequence
TTCTATCTGGAGAACCCCTGAGAACAAACCGGGTGCTTCCAGCAATTCCAAGCCAGAGGGGACATGACCCATCACCAGCT
GGAGAGAGCCAGAGGGGACATGACCCACCACGAGCTGAAGAGAGCGGGGGTTCCTCCAGTCCCACCCATGATGAAAACTA
ACTACAGCTCGCTCTCTGTGGAAATGGAGAAGATATATATTTTTCGACTTCCCAAGGGTGAGATTACTCTAGTTTATATG
AGCAAAGTCTTAATTTAGTAAGCTGCATTCTACAAGCCATTCATGGTTTTCTAATTCAAGGTTCCTTATTTCAAATAAAT
ACACTCCCTAAATACTCACTTAGAATCTTCAGGCGTGCAAACATCACCAAGTCTATTAGTTTCTGTGACGCCCTACAAAC
TGTAATTGAGAAACAAAATACACTCCTGGAGGAGGATTTAGGTATGTTTCACTTATGGTTGTGCCATGTTTGCTGTTTGG
TCTGGTTCTTTTTTTTTTTTTTTTTTTTCCCCCCTTTTGGGGGGTTTTTTTTTTTTTTTTAAGGGGGGGTTTTGGGGGG
Sequence Type mRNA
Unitrap ID UNI37290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113173627..113174181 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049985 (Ankrd55) NM_029898 ankyrin repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1924568]

 
Come back to gene ENSMUSG00000049985


For any suggestions or comments, please send an email to unitrap@crg.es