Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_449A2-3
Clone ID CMHD-GT_449A2-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_449A2-3
Sequence
AATCTTGACCCTGATTGCATCCTGTTACTTGACTTGTAAACCTCACTCTGTTTGTGCCTGCCCATCAATGCCTTCTTAAT
AAAGGAAAACCCTAGCACCATGGCTGCCTCTCTCAGGCCCCTCTGAGAGGAGGCTGCCCCTGAGTCTTTGTATTTTGTCT
TTCAAGAAACACATGTTGGATGCTTTGTAAAATGTCAAAGATCCCATTGAAAATAAATTTATTTTTATTTTATTTTCT
Sequence Type mRNA
Unitrap ID UNI37292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10860292..10860529 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067577 (A430093F15Rik) RIKEN cDNA A430093F15 gene Gene [Source:MGI Symbol;Acc:MGI:2685520]

 
Come back to gene ENSMUSG00000067577


For any suggestions or comments, please send an email to unitrap@crg.es