Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_450B5-3
Clone ID CMHD-GT_450B5-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_450B5-3
Sequence
TCCTGGACACGCTGGAAGACAACCGGTGATTGGTATCACAGTGCCATCCGCCAGAGTCCCTCCCCAACCCTGGAAGAGGA
GCCAGGAGTGCTCAGCGATCCGGCCCTGCCTGACAAGTTCCAATTTGAGCTCACCTTGGAGGAAGAGGATGAAGAGGATT
CATTGGAGGTTCCAGGATTGCCTTGCACTGAGGAAACCCTCCTGGCTCCACATGATACCAGAGCTCAAGCCATGGAACAG
TCAAAGGTCAAAGGCCAGAGCCCTGCTGTTGTGGAGGTAGCAGAGAGTTTGAAGCAGGAGACAGCCTCAGCACATGGCGC
TCCTGAGGAGTCCGCGGAGGCTGTGGGCCATTCCTTCAGCCTTGAAACCTCTATTCTGCCTGACTTGAGGACCCTGTCCC
CCTCAGAGGAGGCCCAGGGCCTCCTGGGGCCTCCCCTCCATGGCGGCAGAGGTGGAGGCCCCAAGAGACCATCTGGCTGC
CATGAGGGCTTGTTCTGCCTGCTCGGGGACATCAGGAGACAATTCTGCCGTCATCTCTGCTCCAGGCAGGTGGGGGTCAG
GTGGAGACCCTGCCTGATCCCTTTTCCCTTCACCCTCGGCTCCTCCCTCCTCCCCACACTCTCCACTCACCACAGACCAC
CTCAACGACTCCTGGCCCTCCTGAGAAAAAAGAAAACAGAAAAGTGGGGTTTTTTCTCTTTTCTTTTT
Sequence Type mRNA
Unitrap ID UNI20710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21015214..21015919 698
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032177 (Pde4a) NM_019798 phosphodiesterase 4A, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99558]

 
Come back to gene ENSMUSG00000032177


For any suggestions or comments, please send an email to unitrap@crg.es