Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_447D8-3
Clone ID CMHD-GT_447D8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_447D8-3
Sequence
GCACAGCCCCTGCCTGCCTCCTGACAACCCCTTGGACTTTGAGAAAACCGACATGATTGACCGTCCCACTTGATGTCCTC
GCCTAGAAGAGTGACAAGAGTTTTGGAGTCTTGAGGGCCCTGCTGTGTGTCTGGCGCTCCTGGACATCAGGACACTAAAT
AAATAAAGACTGAGTACTGGGCTCTGAAAAAAAAAAAAAAAAAAAAAAAGGGAGAAGAGCGATGATATAAAAATTAATCA
TCCATCCCCCGGCTTTCCTTGGTCTGCCAAGTGAGCGCTCAGGAGGGGCCTGGGTGCTCTTGTTCTAGGCTCAGGAGTAG
GATGACTCAGCCAGCCCTCCCTGGCCCTGCTGTCTGTGTGTTGGAGGTAGGCTTCCCTCCCACTCGTAGTCAACCAGATA
AATGTGTAAGTCTAGGCAGTCCTGAAGCTCACTACGTAGACCTCGATGGATTCAGACTCAACAGCCGTCTCCTGAGTGCC
AGGGCTCTAGGTGTGAACCACAATGCCCAGCTTTCCACACACATGCCAGTGGGCTATGCCCCGCCTACCATTAGTGCCCA
CAGCCTACATTCACTACACCGTAACACTGTTCTCTTGAGACGTGGCAGAGGAGCAATAAATAGCACATTTCTTCCACTGC
TGAATTAGAACCAGTTGAGCAGTAGACATGGACTTTGGGCAGTGGACATAAAAATACTGATCTTATTGAAAACAGCAGTG
CGGAGACAGAAGCAGGGATCAAAAGGT
Sequence Type mRNA
Unitrap ID UNI12980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128959011..128959756 701
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]

 
Come back to gene ENSMUSG00000037938


For any suggestions or comments, please send an email to unitrap@crg.es