Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_334H6-3
Clone ID CMHD-GT_334H6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_334H6-3
Sequence
TGCCTTTCTCCAAAAGGTTTTTGAAATATCCCACCAAAAAATATTAAAAAAAAAACAACCTCCAAAACTGGCTGCTTGTT
GCCCCCAACATCAAAAAAAGTTACAAACTGCGTTACTTCCAAATTAACCAGGATGAAAAGGAGGAGGAAAACAAGGATTA
GGACCCTTTGGTCTGCAATGTTTTGTATTAATTCATAAATAAAATTTAGGAAC
Sequence Type mRNA
Unitrap ID UNI4627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151704222..151706585 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es