Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_261B2-3
Clone ID CMHD-GT_261B2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_261B2-3
Sequence
CTAGCCAAGTCCTGCTGAGGCCCACCTAGTTGCAGGAACATAGGGACCAGGAACTGGAACAGCTGGTCCAACTGCCTGCC
AACAAAAATTCCCTTCTGAAGGATGCCATGGCTCCGGGCACCCCCAAGTCCCTCCTGTTGTCTGCTTCCATCAAGAGGGA
AGGAGACTCTCCAACGGCTTCCCCACACTCTTCTGCCACGGAGGACCTGCACCACTCAAACAGATACCAGACCTTCCTGC
GAGTGCGAGCCAACCGGC
Sequence Type mRNA
Unitrap ID UNI20009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116961646..116980229 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es