Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_271A1-3
Clone ID CMHD-GT_271A1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_271A1-3
Sequence
CACCGAGCTGCAGCAGCTGGAGGTGGAGCTCCAGAGGACCAGCAAGGAGGACACCTGTGTGCAGGCTAGGCTACGTCAGC
TCATCACAGAGCTGCAGGAGCTCAGGGAGATGGAGGAAGAGCTCCAGCGCCAGGAGAGGGATGTAGATGAGGACAACACC
GTCACCATCCCCTCTGCAGTGTATGTGGCTCATCTCTATCACCAAATTAGTAAAATACAGTGGGATTATGAATGCGAGCC
AGGGATGATCAAGGGCATCCACCACGGCCCCACAGTGGCCCAGCCCATCCACTTGGACAGTGCACAGCTCTCGCCGAAGT
TCATCAGTGACTACCTCTGGAGCCTGGTGGACACCACGTGGGAGCCAGAGCCTTGACCTCATACCTTGCACAGAACTGGG
GTTGAGGGAGCCAAGGAGGGGATCACTCTAAAATTAAATGTCTGTATGCGAGAGC
Sequence Type mRNA
Unitrap ID UNI3402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21560542..21562203 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074476 (Spc24) NM_026282 SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914879]

 
Come back to gene ENSMUSG00000074476


For any suggestions or comments, please send an email to unitrap@crg.es