Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_260G1-3
Clone ID CMHD-GT_260G1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_260G1-3
Sequence
CAGGCAAATCAGGGAGCGGTGCCGAGAAAATTTCCTTACTAAATGACATTTCATCGCAATGTCCGATCGTTTGGGGCAAA
TAACCCAGGGCAAGGATGGGAAAAGCAAGTACTCGACTCTCAGCCTGTTTGACAAGTATAAAGGGAGGTCAGTAGGCGCT
GTCAGGTCCTCAGTTATTCCTAGACATGGCTTACAGAGTCTCGGGAAAGTTGCCACAGCCCGGCGTATGCCACCGCCTGC
AAACCTGCCAAGCCTGAAGTCTG
Sequence Type mRNA
Unitrap ID UNI16587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32037976..32038732 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es