Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_259C8-3
Clone ID CMHD-GT_259C8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_259C8-3
Sequence
CTTGCTCCGGTGTCCCCGGAGCTCGTGCTGGCTTCTGTTCGCAGGGTCTTCAGTGCCACGCTGCAGAACTGGCAGACCAC
GCGCTTCATGGAGGTTGAAGTAGCCGTGCGGTTGCTGTACATGCTGGCGGAAGCTCTCCCGGTGTCCCACGGCGCTCACT
TCTCAGGTGACGTGTCAAAAGCGAGTGCTTTGCAGGACATGATGCGGACGCTGGTGACATCAGGAGTCAGCTCCTACCAG
CACACGTCTGTGACCCTGGAGTTCTTTGAAACTGTTGTTCGCTATGAGAAGTTTTTCACAGTTGAACCTCAGCACATTCC
GTGTGTACTCATGGCTTTCTTAGATCACAGAGGTCTGTGGCATTCCAGTGCTAAAGTCCGGAGCAGAACCGCCTACCTGT
TTTCTAGATTTGTCAAATCTCTCAATAAAC
Sequence Type mRNA
Unitrap ID UNI9536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121043297..121044631 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es