Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_269D8-3
Clone ID CMHD-GT_269D8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_269D8-3
Sequence
TTTGGACTCAGACCCTGGGAGCCGGAATAAATGGTCCAGTTAGAGTCTGTGTGAAGAAATCCACTCAAGAACGGTTTGCA
CTGAAAATTCTTCTTGATCGTCCAAAAGCTAGAAATGAGGTGCGCCTGCACATGATGTGTGCCACACACCCCAACATAGT
TCAGATTATTGAAGTGTTTGCTAACAGTGTACAGTTCCCTCATGAGTCCAGCCCCAGGGCTCGACTCTTAATTGTAATGG
AGATGATGGAAGGGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACA
AAGCAGATAGCCCTGGCTCTACAGCACTGTCACTTGCTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTT
CAAGGATAACTCTCTGGACGCCCCTGTGAAATTATGTGACTTTGGGTTTGCTAAAGTTGACCAAGGTGATTTGATGACAC
CCCAGTTTACCCCTTACTATGTAGCACCTCAGGTACTGGAAGCGCAGAGACGGCACCAGAAGGAGAAGTCTGGCATCATA
CCTACCTCGCCAACACCCTACACTTACAACAAGAGCTGTGACTTGTGGTCCCTAGGGGTGATAATTTATGTGATGCTGTG
CGGATATCCTCCTTTTTACTCCAAACACCATAGTCAGACTATCCCAAAGGATATGCAGACAAAGATCATGACACGAAGTT
TCGAGTTCCCAGAAGAAGAGTGGACCCAGATCTCAAAGATGGCTAATGATGTTGTGAGGAAGCTTCTGAAGGTCAAACCA
GAGGAAAGACTCACAAT
Sequence Type mRNA
Unitrap ID UNI21103

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121978964..121990552 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es