Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_260D11-3
Clone ID CMHD-GT_260D11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_260D11-3
Sequence
TTGAGTGGTGATTTTATGCAATGGCTTCAAGCCACAGTTCTTCTCCAGTGCCTCAAGGAAGCAGCAGTGATGTTTTCTTT
AAAAAAGAGGTAGATCCAACAAAACACATTCGACCTGTGCAGTCACTGCCAGATGTGTGTCCCAAGGAACCCACAGGTAA
TTATCATCATTTATGGGCTGCGCCTCATTCAAAAATAAATCTCCCAACATGGTTAAGTGATCCTATCCTAGTAAATCTCC
ACAAACAAAATTAAATGATCCTACACTAGC
Sequence Type mRNA
Unitrap ID UNI18165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21163202..21164747 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020128 (Vps54) NM_139061 vacuolar protein sorting 54 (yeast) Gene [Source:MGI (curated);Acc:Vps54-001]

 
Come back to gene ENSMUSG00000020128


For any suggestions or comments, please send an email to unitrap@crg.es