Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_269A9-3
Clone ID CMHD-GT_269A9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_269A9-3
Sequence
TGTGCCTGACACGAGCACCCAAACCCATCCTGCACCCACCACCAGTAAGCAAAAGCGACGTGAAGCCTGTGCCTGGAGTG
CCCGGCGTGTGCCGCAAGACCAAGAAGAAACACCTCAAGAAAAGCAAGAATCCTGAGGATGTGGTTCGGAGGTACATGCA
GAAGGTGAAAAACCCGCCTGATGAGGACTGTACCATTTGCATGGAGCGGCTGGTCACAGCATCTGGCTATGAGGGCGTGC
TCCGAAACAAGAGTGTGCGGCCCGAGCTTGTGGGCCGCCTGGGCCGCTGCGGCCACATGTATCACCTGCTCTGCCTGGTG
GCCATGTACTCCAATGGCAACAAGGATGGCAGCCTGCAGTGTCCAACCTGCAAAGCCATCTACGGGGAGAAGACAGGGAC
ACAGCCACCAGGGAAGATGGAGTTTCACCTCATCCCGCACTCGCTGCCTGGTTTTGCAGACACCCAGACGATCCGCATCG
TCTATGACATCCCCACGGGCATCCAGGGCCCTGAACATCCCAACCCAGGCAAGAAGTTCACAGCCAGAGGCTTCCCTCGC
CACTGCTACCTACCCAACAATGAGAAGGGCCGAAAGGTGAGTGCCCACCTGGT
Sequence Type mRNA
Unitrap ID UNI13676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121132113..121133426 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029603 (Dtx1) NM_008052 deltex 1 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dtx1-001]

 
Come back to gene ENSMUSG00000029603


For any suggestions or comments, please send an email to unitrap@crg.es