Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_258H1-3
Clone ID CMHD-GT_258H1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_258H1-3
Sequence
TTGCAGGCCTCTAATCCTCTGTGGCAATCCCGGGGCTCCACACGGTGTCTTCAAGAGGACGTTTCCGATGCCCATCTTGT
AGGCACGAGGTTGTCCTGGACAGGCATGGTGTCTATGGCCTGCACCGGAACCTGCTAGTGGAGAACATCATTGACATCTA
CAAGCAGGAGTCCTCCCGGCCACTGCACGCCAAGGCTGAACAGCACCTCATGTGTGACGAGCACGAGGACGAGAAGATCA
ACATCTACTGCCTGAGCTGCGAGGTGCCCACCTGCTCTCTCTGCAAGGTTTTCGGCGCCCACAAGGACTGTGAGGTGGCC
CCTCTGCCCACCATTTACAAACGCCAGAAGAGTGAGCTGAGCGATGGCATCGCGATGCTGGTGGCGGGCAATGACCGTGT
GCAGGCAGTGATCACCCAGATGGAGGAGGTGTGCCAGACCATTGAGGACAACAGCCGCAGACAGAAGCAACTGTTAAACC
AGAGGTTCGAGACCCTGTGCGCGGTTTTGGAGGAGCGCAAGGGCGAACTGCTTCAAGCACTGGCCCGGGAGCAGGAGGAG
AAGTTGCAGCGCGTGCGGGGCCTCATCCGCCAGTACGGAGACCACTTGGAGGGCTCCTCAAAGCTGGTGGAGTCCGCCAT
CCAGTCCATGGAGGAGCCGCAGATGGCTCTCTACCTCCAG
Sequence Type mRNA
Unitrap ID UNI35960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31433412..31438649 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062077 (Trim54) NM_021447 tripartite motif-containing 54 Gene [Source:MGI (curated);Acc:Trim54-001]

 
Come back to gene ENSMUSG00000062077


For any suggestions or comments, please send an email to unitrap@crg.es