Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_265H11-3
Clone ID CMHD-GT_265H11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_265H11-3
Sequence
CTCCTGTACTCCTCTGTGGAGAACATCCAGCGTGTGGCTGCGGGAGTGCTCTGCGAGCTGGCCCAGGACAAGGAGGCTGC
CGACGCCATTGATGCGGAGGGCGCCTCTGCCCCTCTCATGGAGCTACTCCATTCCCGCAATGAGGGCACCGCGACCTACG
CTGCTGCTGTCCTGTTCCGCATCTCTGAGGACAAGAACCCAGATTACCGTAAGCGAGTGTCTGTGGAGCTCACCAATTCC
CTCTTCAAGCATGACCCAGCTGCCTGGGAGGCTGCCCAGAGTATGATCCCGATCAACGAACCCTATGCAGACGACATGGA
TGCCACCTACCGCCCCATGTACTCCAGCGATGTGCCTCTGGACCCTCTGGACATGCACATGGACCTGGATGGAGACTACC
CCATGGACACCTACAGTGACGGCCTGAGGCCTCCCTACCCCACTGCAGACCACATGCTGGCCTAGCCAGCTCCACCTCAG
CGCTGTTTCTCACCTGGAAAGCTCTCAAGAGCAGACTGTGGGAGGAGACAGAAAAGTACCTGAGCCCCGGGGGCCGGCCT
GGACTTCCTGCTGAACACGCGTGCTCCCGTGCTCCAGAGAGTTCCTCCATAGGGATTTTGGGATGGTGTCTGTTCCTGCT
TTTCTGTCCTGGGCTGGGGATCCAGGCTCAGCACTTTCTCCCCGTCCCCACTATGGCTATGGCCACTAAAGCTTTAGACT
CAA
Sequence Type mRNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100232521..100235790 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es