Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_463F7-3
Clone ID CMHD-GT_463F7-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_463F7-3
Sequence
TTACATGTATACATGTATACATTCCATCAAGAAGTGTGACGTTGACATCCGTAAAGACCTCTATGCCAACACAGTGCTGT
CTGGTGGTACCACCATGTACCCAGGCATTGCTGACAGGATGCATAAGGAGATTACTGCTCTGGCTCCTAGCACCATGAAG
ATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCTGCGTGGATAGGAGGGTCTATCCTGGCCTCACTGTCCACCTTCCA
GCAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTGCACCGCAAGTGCTTCTAGGCGGACTGTT
ACTGAGCTGCGTTTTACACCCTTTCTTTGACAAAACCTAACTTGCGC
Sequence Type mRNA
Unitrap ID UNI610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143665420..143665891 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029580 (Actb) NM_007393 actin, beta Gene [Source:MGI Symbol;Acc:MGI:87904]

 
Come back to gene ENSMUSG00000029580


For any suggestions or comments, please send an email to unitrap@crg.es