Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418496
Clone ID OST418496
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418496
Sequence
ACCGTGCCCTTTGTGGNGTGGCTGCGAACTTCACTCTAGGAGAGTGGACTATGTTGGATTCCAGTCAAAAGAAGCTCTAC
AGAGATGTGATGAAGGAGACCTTTTTGAACCTGATCTCTATAGGGAAAACAGAAGAAGAAGATACTGAAGAAGAGTACCA
AAATCCTAAGGGAAACCTGAGAACCCTGATGGTTGAGAGACTCTGTAAATATGATTATGGTAATCAGTATGGAGAAACTC
ACCAACAGAGTCCAGAGCATGTTGCGAATGAAAAAATGCCTCCAGCTATAACAGAATGTGAAAGAGACATCTGTACTCAT
TTACCCTCAGACATGCACTTCAAAGGTCAAACTGGAAAGAAATNATGCCAGTATCAAGAACATACAGAGAAGGCTTTGAA
ACATAAGAACTGTTGGAAGGACTTTCACTTATTCTGAGTTGCTTTGGATGCATAAGAGCCCTCCCATGAGACAGAANCCC
TATGAAGATAAAACAAG
Sequence Type mRNA
Unitrap ID UNI18669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33112865..33114417 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053600 (Zfp472) NP_694703 zinc finger protein 472 Gene [Source:MGI (curated);Acc:Zfp472-001]

 
Come back to gene ENSMUSG00000053600


For any suggestions or comments, please send an email to unitrap@crg.es