Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_464D2-3
Clone ID CMHD-GT_464D2-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_464D2-3
Sequence
GCTGTCTTAGGACCTCTGGCTCTAGAAACAGCAAGGGTCATGGCACCCCACTTGGAAGGATACTCGAAGGCTGTGATGAC
AGTGGCCTTCCTAGCCATCCTGATTACAGCTCCAAATGGAGCCCTCCTCATCGGCATACTGGGACCCAAAATCCTTGAAC
AGAGTGAGGTGACATTCCCTTTGAAAGTTGAGCTCTCGAACTTCCATCATTAAAAAGCTTGCCATCAACAAAAAAAAAAA
AAAAAAAAAAAAAGAAGTAGGAGATGAACTCAGAGTATTAAAAAAACCAAATAAACAAGAAAAAAAAATTTGTATCACCT
CTTTACATTCTCTTTAAAAAACTAGACACACCATTTACCTT
Sequence Type mRNA
Unitrap ID UNI37311

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135060560..135098727 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050150 (Nhedc1) NM_028946 Na+/H+ exchanger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921696]

 
Come back to gene ENSMUSG00000050150


For any suggestions or comments, please send an email to unitrap@crg.es