Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_451G3-3
Clone ID CMHD-GT_451G3-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_451G3-3
Sequence
AGTGTCCAGCACCTTCAAGACCCAGCTGTTTCCAAAAGGTCAACCGGAGCCCTGTCCCCATACAAAAGGCCTTTGCTGTC
AAAGGGCTAAAGATGGAAGCTCAGCCAAAAGCCACACCCCCCAGACCCAGCAAGTCTCACCCAGCTAAACCTACAAACTG
CCAGCAGCAGCGGCCCTCTAGGATCCGCAACTACAACCTCAAGGACTAAGTCTCAGCCTCCTGCAGGAGACTGCACAGGG
GCTCCACCTTGTACGTGGGGCCTGTGGTTATACAAGTTGGGAGTGAGAATACACATGGTATACAGGTGGGTTGTGAGCAC
AGGACAGCATCCCAAATGATGGCCTTTCTGATGCTAAAGAGCAATTAAAGCCTCCTCCATCTGTTTGGACTG
Sequence Type mRNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120687847..120688238 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es