Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_455D9-3
Clone ID CMHD-GT_455D9-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_455D9-3
Sequence
CCTACACGGATGACCTGGGTGCTGTGGGTGGTGCATGCCTAGAGGATGAAGCCAGCGCTCTGCGCCTGGATGAAGACAGC
GAACATCCTCCCATGATTCTCCGGACTGACTGATCCTGACCTGTGAACTCTGGCCCAGGAGCAGACAACACTGCCTGGCT
GAGGACTTGAGCATTGCTGCTATGAACTTTGACCTGAATTGAGGGAGAGGATGGCAGAGACTTAAAGCAGAGGTTGTAGT
TATAGCCTATCCATACTGTTGAGAAAATACAGTTTTCACTTCAGTGACTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAT
TTTCTCTCCTTCTCAATTAATAAAAAAATTTTTTTTTCTTTTTTCTTTTTCTTTTTTGCCAAAATTAACTATTTGGGGAA
GTCTGTGGAGTCTCCTTGCTTTGCATGTGTGATGTGCCAAGCCAGCATAGGAAAGCAAGTGGAGTGGCCACTCCCATAGC
AAACCACAGTTGTCAGGTCTCATGCCAGGGCACGCATGAAAAAGTCTGCGTGCAGTGATTCTGCAGGGACAGGGCCCATG
TGCCCACCAAGACCAGCCAGGGCACCAGTGGACAGTGGCCTCTGTCAGGAGTCCTCTTGCCCTACTGCCCCACCTGGGCC
ATTTTCCCTCCCAATTTATTAAACTCTTTCCAAATTGG
Sequence Type mRNA
Unitrap ID UNI14707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143142814..143143489 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es