Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_455C1-3
Clone ID CMHD-GT_455C1-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_455C1-3
Sequence
TGAATGGGTGTGATTTTGCCAGCTGAAGGCAGTTTACATTCGGAGTTCCGCGGACTCTTCAGAGGCTGTAAAAATGCCGG
AGTCACGAAAGCCTGCAAAGAGCTGTTGCTTGCCTTGCTGCTGCTGCTGCTACTGCCGTCCCTGCCCGTGCTGCAGCTGC
TACTCCTGCTGCTGCTGCTGCTGCTTGTTGCTGATTGTTGCGGTTGCTGGTTGCTGTTTACTGTTTGCTGCCGGCTGGAT
TGCTGGATTGCTGATTGCCAGTCGGCGAAATCCTGGCGATGAAGATCCAACTTGCCCCAAGAAACAAGACGACCCTAAGA
AGTAGTCTAATGATTTCAATACGCCCTTTCCCCCTCTGACCTTTCTCTCTTACCTTATGCTGGGGGATTGGAAGGGTGGC
AGAAAAAAGAACCCAATAAAGTAGCCAAAAGT
Sequence Type mRNA
Unitrap ID UNI14152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6989232..6989658 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063018 (2010204K13Rik) RIKEN cDNA 2010204K13 gene Gene [Source:MGI Symbol;Acc:MGI:1922859]

 
Come back to gene ENSMUSG00000063018


For any suggestions or comments, please send an email to unitrap@crg.es