Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418445
Clone ID OST418445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418445
Sequence
TGGAGGCTGGAAGCGTNTGTGAATGTGGCATCGCAAGAGAGCGAAGTCACGCCCCTGCATGTGGCTGCAGCTCGTGGCCT
GGAACAACATGTGGCCCTCTACCTGCAGAACGGTGCGGACGTGGCTCTGCGCACCAGCCAGGGAGAGACGGCGCTGAAAA
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI18671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102137710..102137866 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034768 (Asb16) NM_148953 ankyrin repeat and SOCS box-containing 16 Gene [Source:MGI (curated);Acc:Asb16-001]

 
Come back to gene ENSMUSG00000034768


For any suggestions or comments, please send an email to unitrap@crg.es