Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_447C9-3
Clone ID CMHD-GT_447C9-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_447C9-3
Sequence
CCGTCCCCACAGTGCCCAGAAGAAACTTCCTCTTAGAAAAGCTGAAAACACAGTATTTATAACACTGGAAATTGTAAAGA
ATTTGTTTAAAATGGCTGAAAACAATAGTAAAAAAG
Sequence Type mRNA
Unitrap ID UNI285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 47909194..47909307 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048379 (Socs4) NM_080843 suppressor of cytokine signaling 6 Gene [Source:MGI (curated);Acc:Socs4-001]

 
Come back to gene ENSMUSG00000048379


For any suggestions or comments, please send an email to unitrap@crg.es