Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_450H6-3
Clone ID CMHD-GT_450H6-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_450H6-3
Sequence
CTCTTCCCACTGCAGACCGGAGGCCCCCTTACCATGCACCTTCCCTCAGAGTGATCCCAGGCTCCAGGGGGAGCTAAGAC
CCTCTTTCTCCCCTTACCTATCCCCAGACTCTTCCACTCCATATAATACTTCCCTTGCTGGAGCCCCCATGCCAGTAACC
CACCTTTAACTGGCAGGGACGCCCAGGGCCAACCCCACAGACCCCTACAGATCTCCAAGGAACCAGAATGGCACACTAAA
CACAATTTTGTACAATTAAAACCATGTTTCGGAG
Sequence Type mRNA
Unitrap ID UNI23638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69469955..69470227 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041287 (Sox15) NM_009235 SRY-box containing gene 15 Gene [Source:MGI (curated);Acc:Sox15-001]

 
Come back to gene ENSMUSG00000041287


For any suggestions or comments, please send an email to unitrap@crg.es