Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_447C12-3
Clone ID CMHD-GT_447C12-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_447C12-3
Sequence
GCTGGTCTCAAACTTCTGAGCCTCTTTGTTCCATATCAAGACAGCTGGAATGGCAGCGGTTACCACTATGGCCAGCTCAT
TCAGTGCTGCAGACTGAACGCAGGGCTCTCTACACACCAAGCAGGCGTTCGGCCAACTGCTATGGCTCCAACCCCATGTT
CTGGACTCTAACTAACTTCTTAAGGGCTAAGAAACACCTAAGAGCTAGTTTTGTCCCCTGACCTGGACACTGCGGTGAGT
TTACAGAACTTACAATCACCCTGTTTTCTGTAGAAGCTGCCTCAACCATCTTGACATGTTTCAAATGTGTGTTCACTTTC
CTCTTCAATGTCCAAGTGCACCAAGCTTGATGGAACGCTGACACAAGTCTAACTGGATCTGTTTTGAATTTGCAAATTGA
CTCTGCATCTAAATAGATATTTGTTGTG
Sequence Type mRNA
Unitrap ID UNI28881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130386232..130386659 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060029 (4930473A02Rik) RIKEN cDNA 4930473A02 gene Gene [Source:MGI Symbol;Acc:MGI:2447823]

 
Come back to gene ENSMUSG00000060029


For any suggestions or comments, please send an email to unitrap@crg.es