Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST418407
Clone ID OST418407
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST418407
Sequence
GAACTGAGGAGCCTTCTCAGGAGGAGCTGACAGCAGAGGACCGCCGGGAGCCCCCTGAACTGAATCCCCAGACAGAGGAA
AGCCAGGATGTGGTACCTTTCTTGGAACAACTAGTCCGGCCTCGAAGAAGTGCTCCTAAAGGCCGGAAGGCGCGGCCTCG
CCGAGCTATTGCAGCCCATTATGAGGTTCATCCTCGGCCAGGACAGGATGGAGCACAAGCAGGTGTGGATGGGACAGTGA
GTGGCTGGGAAGAGACCAAAATCAACAGCTCCAGCCCTCTGCGCTACGACCGCCAGATTGGGGAATTTACAGTCATCAGG
GCTGGGCTCTACTACCTGTACTGTCAGGTGCACTTTGATGAGGGAAAGGCTGTCTACCTGAAGCTGGACTTGCTGGTGAA
CGGTGTGCTGGCCCTGCGCTGCCTGGAAGAATTCTCAGCCACAGCAGCAAGCTCTCCTGGGCCCCAGCTCCGTTTGTGCC
AG
Sequence Type mRNA
Unitrap ID UNI17242

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69500459..69508945 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es