Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_445D4-3
Clone ID CMHD-GT_445D4-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_445D4-3
Sequence
CCTTGGGCTCTCTGGCGTGAACATTTTGTGGATCTTTGGAGAGTAGTTCCTCATTTAATTCCAAACATTTGGACTTTGCT
TTTAACTGGTCTGGAAGAAGTTGGAGCTGAGCCCCTCCGAGTGCGCACCTCTTCTGACATAAGATGCATGTTTTGCAGAC
TTGTTAAATTTAACAGGAGACAAGCTGTGGGAGCTTCTTGTGAGCATAGCAAAGCCTGCACCTTCTAGTCCACAGAAAAG
CATTACACTGGATGGCTCTGAGCGAGCTAGTGCCGCTCCCTTCATTTGGTGAGGGCAAGGACGCCTCTCCATTTTAACCC
CAGTGAGAACCTGCACCTCATCCTGTACCATCAGAGACTGCTTTCATTGTTGGATAGTAGTGTAAGTTCTCAGATGAACC
TTGCTAGTTCTCTTTGTTGTATCTTTATATTTCCCCAGTGTTCTACAAGTCAGCCTAAAGCTGAAATGAAATTAATTTCT
AAGTGATGTAGTAATTAATCCTGCTGAGCCATCTCCCCAACCCCCTATTGTTTTTTTTAATATTAAAAGAGATTTGATAA
TATTGACATCTTGAAAGGACAATGCTTGCATTCTCTTTGCTGATT
Sequence Type mRNA
Unitrap ID UNI37330

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30432372..30432976 589
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029782 (Tmem209) NM_178625 transmembrane protein 209 Gene [Source:MGI (curated);Acc:Tmem209-004]

 
Come back to gene ENSMUSG00000029782


For any suggestions or comments, please send an email to unitrap@crg.es