Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_452H3-3
Clone ID CMHD-GT_452H3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_452H3-3
Sequence
TTGATCCAGAGTACCAGAAGGAAGCAGAACAGAGACATCGGGAATTGGCAGCGAAAGCTGGAGGATTTAATGACTTTGCA
ACTTTAGCTGTCATTTTTGAACAGTGCAAATCAAGTGGAGCTCCGGCTTCGTGGTGCCAGAAGCACTGGATTCACTGGCG
GTGCTTATTCTCTGCATTTCGTGTGGAAGCTCAACTTCGGGAACTGATCAGGAAACTAAAGCAGCAAAGTGATTTCCCAA
GAGAGACTTTTGAAGGCCCTAAACATGAAGTACTACGAAGATGTCTTTGTGCAGGCTACTTCAAAAATGTTGCTCGAAGA
TCTGTTGGCAGAACATTTTGCACAATGGATGGGCGTGGAAGTCCAGTTCATATCCATCCTTCCTCAGCACTTCATGAACA
GGAAACCAAACTTGAATGGATAATTTTTCATGAAGTATTAGTTACCACCAAAGTCTATGCAAGAATTGTGTGCCCAATCC
GTTATGAATGGGTGAGAGACTTACTACCCAAGTTGCATGAACTTAATGCGCATGATTTGAGCAGTGTGGCTAGACGTGAA
ATGAGAGAAGATGCAAGAAGAAAATGGACAAATAAGGAAAATGTGAAACAGCTAAAGGATGGAATATCAAAAGAAGTTCT
AAAGAAAATGCAAAAAAGAAATGATGACCAATCCATATCAGATGCACGGGCT
Sequence Type mRNA
Unitrap ID UNI6310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86583690..86590231 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es