Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_437A5-3
Clone ID CMHD-GT_437A5-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_437A5-3
Sequence
GAAGCTATGCTCTACCACAACCAGACCTCTGAGCTCCGGGAGTTGCTAGACTTCACACACATGTACCTTCAGTCAGACGA
TGAGATGGAACTGGAGGAGACAGAATCACTCCCAGAGCCTGGAAGAACCTCTATCTGATGCTGAGTTCGAAGGCGAGGGC
GACTATGAGGAAGGTCTCTATGCTGACTGGTGGCAAGAGCCAGAAGCCAAGGGTGACGAGGCCGAGGCCGAGCCAGAGCC
TGAACTGACATAAGGCGGTGACATGGCGCACTCTTCAAGCTCAGGACACCTGGCTGGGGGCAAGAACTATTTATTAAAAC
TTAAAATAGCCAGGTGTGGTGGCACACACCCTTAACCCTGGCACCCGGGGGAGGCAGAAGCAGGCAGATCTCGGGACCAG
CCCAGCCTACACAGTGAGATCCTGGCCAGGCCAGGCTACATAATGAGATTTTGTTTCAAAACAAAAACAACTGAGTGTGG
CATCACATGCCTTTAATTGCAGCAGCTGGGATGCAGGGGCAGGTGGATTGCGGTGAGTTTCAGGCTAGCCTGTAGTGAGT
TCTAGGCCAGTAGAGGCTCTGTTGTAAGACCCTGTCTCAAAATAAAACAAAAGGAAAAACCTT
Sequence Type mRNA
Unitrap ID UNI37334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100270066..100272511 394
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006931 (1110036O03Rik) NM_176830 RIKEN cDNA 1110036O03 gene Gene [Source:MGI Symbol;Acc:MGI:1913430]

 
Come back to gene ENSMUSG00000006931


For any suggestions or comments, please send an email to unitrap@crg.es