Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_430H6-3
Clone ID CMHD-GT_430H6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_430H6-3
Sequence
TGCAGGTGAAACAATCGCCTCACTCACAGATGTGACTAAACGGAGCCATTTGGAATCAGATGGTCAGGTCACGATTCTGA
CAGACAAAACAGGCGTCGTGCAGGCCGCCCGGCTGCTGCTCTCCTCAGTGACAAAAGTGCTGCTGCTGGCAGATCGTGTA
GTCATCAAGCAGATAGTGACATCGAGAAACAAGATTCTCGCAACCATGGAAAGGCTAGAGAAAGTAAACAGCTTTCAGGA
ATTTGTTCAGATATTCAGCCAGTTTGGAAACGAAATGGTGGAGTTTGCACATCTAACGGGAGACCGAC
Sequence Type mRNA
Unitrap ID UNI13108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56854438..56857508 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es