Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_430B10-3
Clone ID CMHD-GT_430B10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_430B10-3
Sequence
GCAGCTAAGAATGGAGCAGCAGGTGTGGAGCTGGACATCGAGTTTACTTCTGATGGAGTTCCTGTCTTGATGCACGATAA
CACAGTAGATAGGACAACAGACGGGTCTGGCCGACTATGTGATCTGACATTTGAACAAGTTAGGAAACTTAACCCTGCAG
CAAATCACAGACTCAGAAACGAGTTCCCTGACGAAAGGATCCCTACCCTGAAGGAAGCTGTCACAGAGTGCCTCCGCCAT
AACCTCACCATCTTCTTTGATGTCAAAGGCCATGCAGATATGGCTTCTGCTGCTCTAAAAAATATATACACGGAATTTCC
ACAGCTGTACAATAACAGTATGGTCTGCTCATTCTTGCCGGAAGTCATCTATAAAATGAGACAAACGGATCAGAAGGTAA
TCACAGCCCTAACTCACAGGCCTTGGAGCCTGAGCCACACTGGAGATGGGAAGCCTCGCTACAGCGTCTTTTGGAAGCAG
TCTGTGTTTGTGGTGTTGGACATCTTGCTGGACTGGAGCATGCACAATGTCTTGTGGTACCTGTGTGGGATTTCAGCCTT
CCTCATGCAGAAGGATTTTGTCTCCCCGGACTATTTGAAGAAGTGGTCAGCTAAAGGAATCCAGGTTGTGAGTTGGACTG
TCAATACCTTTGATGAAAAGAATTACTACGAGTCCCACCTTGGGTCCAGCTACATCACTGACAGCATGCTAAAAGACTGT
GCACCTCACTTCTACACTCCGCAGGAAGACACACAGTTGCGAAACTGCCTGGAGGCCTCTTGCAG
Sequence Type mRNA
Unitrap ID UNI13704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 125832467..125842244 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033917 (Mir16) NM_019580 glycerophosphodiester phosphodiesterase 1 Gene [Source:MGI (curated);Acc:Mir16-001]

 
Come back to gene ENSMUSG00000033917


For any suggestions or comments, please send an email to unitrap@crg.es