Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_437A3-3
Clone ID CMHD-GT_437A3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_437A3-3
Sequence
GAACCAGGATTATCTATGACCGGAAATTTCTGATGGAGTGTCGGAACTCACCTGTGGCCAAAACACCCCCAAAGGACCTG
CCAGCCATTCCTGGGGTCACTAGCCCTACCAGCGATGAGCCTCCCATGCAAGCCAGCCAGAGCCAACTGCCCAGCAGCCC
GGAAGATAAGCGGGCAGGCGGTGAAGAGTCACAATTTGAGATGGACATTTAAGGGACCAGCCGTAGGACGCAATGATGCT
TCTATGTCCCCCAAGGCCCTTGGGAGGAGAGCTGCACAGCATTCAGGCCTCATACCAGGCAGACACTGGGTGTGGGTCGG
CCACCCAGTCCTGCTCCTCACTCAGGGTGCCAGCTCTGCCTTGAATTTTGTGAACACCAGCACATACCTCCTTGTGCCTC
TGTCTATACCGAGCTGCTACTGCAGGGGAATGACTCTCACTCACACCCTCCCTGCATGGAGCTCCAGCGAGTGGACTCAG
AGGAGTCTATCAGAATGATCTGGCAATCCTAGCCCCAGCCTCCGGAGCACACCCATCTTTCCTTAGGCTGGGTTACCTGG
GAAAGCCACACTTTTACTTCTTTCCCTGACAGGAAATAAAAGCCACATTTACCCT
Sequence Type mRNA
Unitrap ID UNI2895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28383795..28385986 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]

 
Come back to gene ENSMUSG00000031490


For any suggestions or comments, please send an email to unitrap@crg.es