Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_452A5-3
Clone ID CMHD-GT_452A5-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_452A5-3
Sequence
GGAAAATCGCCCGCCATGGAGGCTGTCCGCATGATCCCCCCACTGCTGCTCAACGTGGAGCCACACCATAAGATCTTAGA
CATGTGTGCAGCCCCTGGATCCAAGACCACACAGTTAATTGAAATGTTGCATGCAGACATGAGTGTGCCCTTTCCAGAGG
GATTTGTAATCGCAAATGACGTGGACAACAAGCGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGTTGAGCAGTCCCTGC
ATCATGGTGGTAAACCATGACGCATCCAGCATACCTAGACTTACAGTAGATGTGGACGGAAGGAAAGAGATTCTCTTCTA
TGATCGAATTTTATGTGATGTCCCTTGCAGTGGCGATGGCACAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAATGGTCT
TTCTTTTACAACTTAAAAAAAAATGGCCTGCAGCTTCGGATTGCAACTCGAGGTGCTGAGCAGCTGGCGGAAGGTGGCAG
GATGGTGTATTCCACGTGTTCCTTGAACCCCGTGGAGGATGAAGCAGTGATCGCAGCTCTGCTAGAGAAGAGTGAAGGAG
CTCTTGAGCTTGCTGATGTGTCTGCTGAGTTGCCAGGACTGAAGTGGATGCCTGGAGTCTCACAGTGGAAGGTCATGACT
AGAGACGGGCAGTGGTTTGCAGACTGGCATGAGGTTCCCCAGGGCAGGCATACACAAATCCGACCTACCATGTTCCCACC
AACGGACCTGGAGAAGCTACAGGCAATGCATCTAGAGCGATGCC
Sequence Type mRNA
Unitrap ID UNI37337

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69756284..69766044 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]

 
Come back to gene ENSMUSG00000021595


For any suggestions or comments, please send an email to unitrap@crg.es