Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_452F8-3
Clone ID CMHD-GT_452F8-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_452F8-3
Sequence
GCCTATGAGAGGAGGTTTCCTACCTGTCCTCTGATTCCAATGTTCGTGGACAGTGACACTGTGAGCGAGTTCAAGAGTGA
GGATGGGGCTCTTCATGTCATCGAGAGGCGCTGCAAGCTGGATATAGATGCGCCCAGGCTGTTGAAGAAGATCGCAGGAG
TCGATTACGTTTATTTTGTCCAGAAAAACTCCCTGAATTCTCGAGATCGCACTTTGCACATCGAGGCCCACAATGAGACA
TTTTCTAACCGGGTCATCATCCACGAACACTGCTGTTACACGGTTCACCCTGAGAATGAAGACTGGACCTGTTTCGAACA
GTCTGCAAGTTTAGATATCAAATCCTTCTTTGGTTTTGAAAGTACAGTGGAAAAAATTGCCATGAAACATTATACAAGCA
AC
Sequence Type mRNA
Unitrap ID UNI18413

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117002732..117004720 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020823 (Sec14l1) NM_028777 SEC14-like 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec14l1-007]

 
Come back to gene ENSMUSG00000020823


For any suggestions or comments, please send an email to unitrap@crg.es