Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_425D9-3
Clone ID CMHD-GT_425D9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_425D9-3
Sequence
GTCTCCGCTGGAGCCTAGACTTGAGAAGAAGCAACCCGCCTTGGTTGGAACCTTGCTGCAGGTTTGAAGGTGGGATTCAT
CCTGATCCTAAAGACTCGGTCCACCTATCTCCGTGGAGGGAATACAGCAGAAGCCACC
Sequence Type mRNA
Unitrap ID UNI37341

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131285125..131285572 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050394 (Armcx6) NM_001007578 armadillo repeat containing, X-linked 6 Gene [Source:MGI (curated);Acc:Armcx6-001]

 
Come back to gene ENSMUSG00000050394


For any suggestions or comments, please send an email to unitrap@crg.es