Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_437C3-3
Clone ID CMHD-GT_437C3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_437C3-3
Sequence
CTGTACGAGCTGAACGGGGATTCTGAACTCTTGATTCATGTATTTCCATGTGTACCAGAGCGTCCTGGAATGCCTTGCCC
AGGGGAATACAAGTCCATTTACCGTAGAGGGGCACGCCGGTGGAGAAAGCTGTATTGTGCAAATGGCCACACTTTTCAAG
CCAAACGTTTCAATAAGCGCGCCCGCTGTGCCATCTGCACAGACAGAATCTGGGGCCTCGGACGACAAGGATACAAGTGC
ATCAACTGCAAACTGCTGGTTCATAAGAAGTGCCACAAGCTGGTCACAATTGAGTGTGGGCGGCACTCTTTGCCACCGGA
ACCCATGATGCCAATGGACCAGACCATGCATCCAGACCACACACAGACAGTAATTCCATATAATCCTTCAAGTCATGAGA
GTTTGGACCAAGTTGGTGAAGAAAAGGAGGCAATGAACACCAGGGAGAGTGGTAAAGCGTCGTCCAGTCTAGGTCTGCAG
GATTTCGATTTGCTTCGAGTTATAGGGAGGGGAAGTTACGCCTAAGTACTGTTGGTTC
Sequence Type mRNA
Unitrap ID UNI17288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30924102..30936876 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037643 (Prkci) NP_032883 protein kinase C, iota Gene [Source:MGI Symbol;Acc:MGI:99260]

 
Come back to gene ENSMUSG00000037643


For any suggestions or comments, please send an email to unitrap@crg.es