Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_443B8-3
Clone ID CMHD-GT_443B8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_443B8-3
Sequence
GCCACTGGCGCGCATGGAGCTCTTCATATACTTCACCTCCATTCTGCAGAACTTCACATTGCAGCCGCTGGTGGATCCTG
AGGACATCGACCTGACCCCGCTCAGCTCAGGGCTGGGCAATTTGCCAAGGCCTTTCCAGCTGTGTATGCACATTCGCTGA
GTACTGCGCCCAGGGACCCCTGTCCTTCTTCCAGTTGGGGTTCACTGTCATAGGCCTCCATTGATATCTCTCTCACATGA
TCTTCCCTTAACCCTGGGCCTGCCACGTATCAGTACTTTACCCCGCCTATCTTAAGCCCATCTTCATGGAAAGAATGACG
TGACAAAGGTGAAATACCCGTCTTATACGCACAGAACCTATTCTATGATGCACCCTTTTCCTGTCTGTTTGTATCATTTC
CTAGTAAATATCTTAATAACTGATG
Sequence Type mRNA
Unitrap ID UNI37345

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27918257..27918681 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052974 (Cyp2f2) NM_007817 cytochrome P450, family 2, subfamily f, polypeptide 2 Gene [Source:MGI (curated);Acc:Cyp2f2-001]

 
Come back to gene ENSMUSG00000052974


For any suggestions or comments, please send an email to unitrap@crg.es