Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_444B11-3
Clone ID CMHD-GT_444B11-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_444B11-3
Sequence
GTTCATGCCTTCCTTTCTCCGCTTGGGATCCTGGAACGTAGTGATGTTTGTCACCTATGAGCAGCTCAAAAGAGCCCTAA
TGGCTGCCTACCAATCTCGGGAGGCACCTTTCTGAGCCTCTCCATGCTGACCTGGACCCTGCTTCCCAGCCCTGCCCTGT
CTTTTTCTTCATCCTCTGCCCAGTCCCATTCTCTTCCCATTTCCTGCACCCCGATTTACTTCCCACCTCACCTCCCTGTG
CCTCTGTACTGATGACTCACAGTGAGGAGGCCTGACACCAGACCCTGGAGCCCTCAGCCCTTTCTACAGCTAAGCCCACA
TCTTCATCTTCATCCCCAGCCCAGCCCAGCCCAGCTCAGCCAGCCTTCACCCATAAAGCAAGCTCAATGTT
Sequence Type mRNA
Unitrap ID UNI32057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107647745..107648134 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es